Propagation of PadR regulog to Bacillus licheniformis DSM 13
| Source regulog: | PadR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Phenolic acid stress response |
| Effector: | p-Coumaric acid; Ferulic acid |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus licheniformis DSM 13 |
| Orthologous TF(s) | BLi03079 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -58
Score: 6.6 Sequence: ATATATGTAAATATCAACATGTTT
Locus tag: BLi03407
|
||||
| BLi03407 | -58 | 6.6 | ATATATGTAAATATCAACATGTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: padC | ||||
| Ortholog function: Phenolic acid decarboxylase (EC 4.1.1.-) | ||||
| Bacillus amyloliquefaciens FZB42 | RBAM_031730 | -95 | 7.1 | AAACGTGTAAATAGTTACATGTTT |
| Bacillus licheniformis DSM 13 | BLi03407 | -58 | 6.6 | ATATATGTAAATATCAACATGTTT |
| Bacillus pumilus SAFR-032 | BPUM_0712 | -59 | 6.9 | AAACATGTAAATCACGACATGTTT |
| Bacillus subtilis subsp. subtilis str. 168 | BSU34400 | -48 | 6.8 | GAACATGTAAATAGTTACATGATT |