Propagation of BltR regulog to Bacillus sp. B14905
| Source regulog: | BltR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus sp. B14905 |
| Orthologous TF(s) | BB14905_08368 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -67
Score: 6.6 Sequence: GACTATATAGTAACTATATACTT
Locus tag: BB14905_08373
|
||||
| BB14905_08373 | -67 | 6.6 | GACTATATAGTAACTATATACTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: bltD | ||||
| Ortholog function: Spermine/spermidine acetyltransferase | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU26600 | -104 | 6.6 | GACTATACGGTAACCATATACCT |
| Bacillus amyloliquefaciens FZB42 | RBAM_006040 | -120 | 6.4 | GACTATACGGTAACCATATCCTT |