Propagation of YhcF regulog to Bacillus halodurans C-125

Reference regulog properties
Source regulog:	YhcF - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus halodurans C-125
Orthologous TF(s)	BH0383
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Bacillus halodurans C-125*
	Locus tag	Position	Score	Sequence
Position: -51 Score: 6 Sequence: GTGTACTATTTCATTAGCACAA Locus tag: BH0384
	BH0384	-51	6	GTGTACTATTTCATTAGCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: BH0384
Ortholog function: Hypothetical protein
Bacillus halodurans C-125	BH0384	-51	6	GTGTACTATTTCATTAGCACAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --