Propagation of BltR regulog to Bacillus halodurans C-125
| Source regulog: | BltR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus halodurans C-125 |
| Orthologous TF(s) | BH4046, BH4047 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -65
Score: 5.9 Sequence: GACTATCGTGTTACACCACACCT
Locus tag: BH4045
|
||||
| BH4045 | -65 | 5.9 | GACTATCGTGTTACACCACACCT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: BH4045 | ||||
| Ortholog function: MATE family multidrug export protein | ||||
| Bacillus halodurans C-125 | BH4045 | -65 | 5.9 | GACTATCGTGTTACACCACACCT |