Propagation of MsmR regulog to Bacillus halodurans C-125
| Source regulog: | MsmR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Alpha-galactosides utilization |
| Effector: | Alpha-galactosides |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus halodurans C-125 |
| Orthologous TF(s) | BH2227 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -97
Score: 5.8 Sequence: TATTGAAAACGCTTACCCTA
Locus tag: BH2227
|
||||
| BH2227 | -97 | 5.8 | TATTGAAAACGCTTACCCTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: msmR | ||||
| Ortholog function: Transcriptional regulator of alpha-galactoside utilization, LacI family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU30260 | -88 | 5.5 | TATTGTAACCGCTTACTTTT |
| Bacillus amyloliquefaciens FZB42 | RBAM_027180 | -93 | 5.4 | TGTTGAAAACGCTTACTCTC |
| Bacillus pumilus SAFR-032 | BPUM_1754 | -80 | 4.4 | ACTTGAAAGCGCTTTACCAA |
| Bacillus licheniformis DSM 13 | BLi01139 | -77 | 4.6 | TATTGAAAACTTTTACCTTG |
| Bacillus halodurans C-125 | BH2227 | -97 | 5.8 | TATTGAAAACGCTTACCCTA |