Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of AseR regulog to Bacillus halodurans C-125

Reference regulog properties
Source regulog: AseR - Bacillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus halodurans C-125
Orthologous TF(s) BH3000
Regulated genes 1
Built upon 13 sites [see more]
Predicted regulatory interactions in Bacillus halodurans C-125
Locus tag Position Score Sequence
Position: -55
Score: 7.2
Sequence: TATATAAGTATATGTTTATATA
Locus tag: BH3000
BH3000 -55 7.2 TATATAAGTATATGTTTATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: aseR
Ortholog function: Transcriptional regulator of arsenic resistance, ArsR family
Bacillus halodurans C-125 BH3000 -55 7.2 TATATAAGTATATGTTTATATA
© 2009-2020 RegPrecise