Propagation of AseR regulog to Bacillus halodurans C-125
| Source regulog: | AseR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Arsenic resistance |
| Effector: | Arsenite |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus halodurans C-125 |
| Orthologous TF(s) | BH3000 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -55
Score: 7.2 Sequence: TATATAAGTATATGTTTATATA
Locus tag: BH3000
|
||||
| BH3000 | -55 | 7.2 | TATATAAGTATATGTTTATATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: aseR | ||||
| Ortholog function: Transcriptional regulator of arsenic resistance, ArsR family | ||||
| Bacillus halodurans C-125 | BH3000 | -55 | 7.2 | TATATAAGTATATGTTTATATA |