Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GanR regulog to Bacillus halodurans C-125

Reference regulog properties
Source regulog: GanR - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactan utilization
Effector: Beta-galactosides
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus halodurans C-125
Orthologous TF(s) BH2018
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Bacillus halodurans C-125
Locus tag Position Score Sequence
Position: -127
Score: 5.9
Sequence: TTTCCGAAAATATTTTACTCAT
Locus tag: BH2019
BH2019 -127 5.9 TTTCCGAAAATATTTTACTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ganO
Ortholog function: Arabinogalactan oligomer ABC transporter, binding protein
Bacillus subtilis subsp. subtilis str. 168 BSU34160 -109 5.9 TTAGGTAAAAAAATTTACTCTA
Bacillus pumilus SAFR-032 BPUM_3613 -126 6.8 TTGAGTAAAAAATTTTACTTAA
Bacillus licheniformis DSM 13 BLi04280 -110 5.8 TTTCGTAAAACATTTTACCTGT
Bacillus halodurans C-125 BH2019 -127 5.9 TTTCCGAAAATATTTTACTCAT
Bacillus clausii KSM-K16 ABC3520 -108 7.2 TTAAGTAAAATATTTTACTAAA