Propagation of GanR regulog to Bacillus halodurans C-125
| Source regulog: | GanR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactan utilization |
| Effector: | Beta-galactosides |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus halodurans C-125 |
| Orthologous TF(s) | BH2018 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -127
Score: 5.9 Sequence: TTTCCGAAAATATTTTACTCAT
Locus tag: BH2019
|
||||
| BH2019 | -127 | 5.9 | TTTCCGAAAATATTTTACTCAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ganO | ||||
| Ortholog function: Arabinogalactan oligomer ABC transporter, binding protein | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU34160 | -109 | 5.9 | TTAGGTAAAAAAATTTACTCTA |
| Bacillus pumilus SAFR-032 | BPUM_3613 | -126 | 6.8 | TTGAGTAAAAAATTTTACTTAA |
| Bacillus licheniformis DSM 13 | BLi04280 | -110 | 5.8 | TTTCGTAAAACATTTTACCTGT |
| Bacillus halodurans C-125 | BH2019 | -127 | 5.9 | TTTCCGAAAATATTTTACTCAT |
| Bacillus clausii KSM-K16 | ABC3520 | -108 | 7.2 | TTAAGTAAAATATTTTACTAAA |