Propagation of GutR regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog:	GutR - Bacillales
Regulator type:	Transcription factor
Regulator family:	GutR
Regulation mode:	activator
Biological process:	Sorbitol utilization
Effector:	Sorbitol
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s)	BsubsS_010100003464
Regulated genes	2

Built upon 4 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. SMY*
	Locus tag	Position	Score	Sequence
Position: -88 Score: 7.3 Sequence: ATAAAAGGACAGCGGCACTGTACTTTTAT Locus tag: BsubsS_010100003464
	BsubsS_010100003464	-88	7.3	ATAAAAGGACAGCGGCACTGTACTTTTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gutR
Ortholog function: Transcriptional regulator of the sorbitol operon
Bacillus amyloliquefaciens FZB42	RBAM_006530	-89	6.8	ATAAAAGGACAGCCGCACTGTACTTTTTA
Bacillus subtilis subsp. subtilis str. 168	BSU06140	-88	7.3	ATAAAAGGACAGCGGCACTGTACTTTTAT

Position: -70 Score: 7.3 Sequence: ATAAAAGTACAGTGCCGCTGTCCTTTTAT Locus tag: BsubsS_010100003469
	BsubsS_010100003469	-70	7.3	ATAAAAGTACAGTGCCGCTGTCCTTTTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gutB
Ortholog function: Sorbitol dehydrogenase (EC 1.1.1.14)
Bacillus amyloliquefaciens FZB42	RBAM_006540	-140	6.8	TAAAAAGTACAGTGCGGCTGTCCTTTTAT
Bacillus subtilis subsp. subtilis str. 168	BSU06150	-142	7.3	ATAAAAGTACAGTGCCGCTGTCCTTTTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --