Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YvbF/YvaV regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog: YvbF/YvaV - Bacillales
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode: repressor
Biological process: Osmotic stress response
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s) BsubsS_010100018341, BsubsS_010100018391
Regulated genes 4
Built upon 12 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. SMY
Locus tag Position Score Sequence
Position: -110
Score: 7.1
Sequence: TAAACTTTTTATTTTATAAACTTTA
Locus tag: BsubsS_010100018336
BsubsS_010100018336 -110 7.1 TAAACTTTTTATTTTATAAACTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: opuCA
Ortholog function: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA
Bacillus amyloliquefaciens FZB42 RBAM_031050 -111 7.8 TAAACTTTTTAATTTACAAAGTTTA
Bacillus amyloliquefaciens FZB42 RBAM_031050 -111 7.8 TAAACTTTTTAATTTACAAAGTTTA
Bacillus subtilis subsp. subtilis str. 168 BSU33730 -110 7.1 TAAACTTTTTATTTTATAAACTTTA
Position: -198
Score: 7.1
Sequence: TAAAGTTTATAAAATAAAAAGTTTA
Locus tag: BsubsS_010100018341
BsubsS_010100018341 -198 7.1 TAAAGTTTATAAAATAAAAAGTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yvaV
Ortholog function: Transcriptional regulator of choline transport, MarR family
Bacillus amyloliquefaciens FZB42 RBAM_031060 -199 7.8 TAAACTTTGTAAATTAAAAAGTTTA
Bacillus subtilis subsp. subtilis str. 168 BSU33740 -198 7.1 TAAAGTTTATAAAATAAAAAGTTTA
Position: -85
Score: 7.5
Sequence: TAAACTTTTTATTTTACAAAGTTCA
Locus tag: BsubsS_010100018386
BsubsS_010100018386 -85 7.5 TAAACTTTTTATTTTACAAAGTTCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: opuCA
Ortholog function: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA
Bacillus pumilus SAFR-032 BPUM_3043 -89 7.4 TAAACTTTTTATTTTATAAAGTTTG
Bacillus subtilis subsp. subtilis str. 168 BSU33830 -85 7.5 TAAACTTTTTATTTTACAAAGTTCA
Position: -203
Score: 7.5
Sequence: TGAACTTTGTAAAATAAAAAGTTTA
Locus tag: BsubsS_010100018391
BsubsS_010100018391 -203 7.5 TGAACTTTGTAAAATAAAAAGTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yvbF
Ortholog function: Transcriptional regulator of choline transport, MarR family
Bacillus amyloliquefaciens FZB42 RBAM_031110 -201 7 TGAAATTTGTAAAATAAAAAGTTTA
Bacillus subtilis subsp. subtilis str. 168 BSU33840 -203 7.5 TGAACTTTGTAAAATAAAAAGTTTA
© 2009-2020 RegPrecise