Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YybR/YdeP regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog: YybR/YdeP - Bacillales
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: activator
Biological process: Multidrug resistance
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s) BsubsS_010100002979, BsubsS_010100021896
Regulated genes 5
Built upon 21 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. SMY
Locus tag Position Score Sequence
Position: -35
Score: 6.2
Sequence: TAGTATCAAAAAGTATACTA
Locus tag: BsubsS_010100002979
BsubsS_010100002979 -35 6.2 TAGTATCAAAAAGTATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yybR
Ortholog function: Transcriptional regulator, HxlR family
Bacillus amyloliquefaciens FZB42 RBAM_037620 -33 6 TAGTATCAAAAAAGGTACTA
Bacillus cereus ATCC 14579 BC3320 -42 6.3 TAGTATCAAAAAAGATACTA
Bacillus halodurans C-125 BH0737 -49 5.2 TAGTTACATGTAGGTTACTA
Bacillus subtilis subsp. subtilis str. 168 BSU05290 -35 6.2 TAGTATCAAAAAGTATACTA
Bacillus subtilis subsp. subtilis str. 168 BSU40540 -34 6 TAGTATCAAAAAAGGTACTA
Paenibacillus sp. JDR-2 Pjdr2_4452 -72 6 TAGTATTAAAAAGGATACTA
Position: -95
Score: 6.2
Sequence: TAGTATACTTTTTGATACTA
Locus tag: BsubsS_010100002984
BsubsS_010100002984 -95 6.2 TAGTATACTTTTTGATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ydeQ
Ortholog function: Putative NAD(P)H oxidoreductase
Bacillus subtilis subsp. subtilis str. 168 BSU05300 -95 6.2 TAGTATACTTTTTGATACTA
Position: -103
Score: 6
Sequence: TGGTATCAAAATTGATACTA
Locus tag: BsubsS_010100004354
BsubsS_010100004354 -103 6 TGGTATCAAAATTGATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfkO
Ortholog function: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34)
Bacillus amyloliquefaciens FZB42 RBAM_008000 -100 5.5 CAGTATCAAAATGAATACTA
Bacillus licheniformis DSM 13 BLi00813 -117 6.3 TAGTATAAAAAATGATACTA
Bacillus subtilis subsp. subtilis str. 168 BSU07830 -103 6 TGGTATCAAAATTGATACTA
Paenibacillus sp. JDR-2 Pjdr2_4453 -145 6 TAGTATCCTTTTTAATACTA
Position: -34
Score: 6
Sequence: TAGTATCAAAAAAGGTACTA
Locus tag: BsubsS_010100021896
BsubsS_010100021896 -34 6 TAGTATCAAAAAAGGTACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yybR
Ortholog function: Transcriptional regulator, HxlR family
Bacillus amyloliquefaciens FZB42 RBAM_037620 -33 6 TAGTATCAAAAAAGGTACTA
Bacillus cereus ATCC 14579 BC3320 -42 6.3 TAGTATCAAAAAAGATACTA
Bacillus halodurans C-125 BH0737 -49 5.2 TAGTTACATGTAGGTTACTA
Bacillus subtilis subsp. subtilis str. 168 BSU05290 -35 6.2 TAGTATCAAAAAGTATACTA
Bacillus subtilis subsp. subtilis str. 168 BSU40540 -34 6 TAGTATCAAAAAAGGTACTA
Paenibacillus sp. JDR-2 Pjdr2_4452 -72 6 TAGTATTAAAAAGGATACTA
Position: -190
Score: 6
Sequence: TAGTACCTTTTTTGATACTA
Locus tag: BsubsS_010100021901
BsubsS_010100021901 -190 6 TAGTACCTTTTTTGATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppaC
Ortholog function: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
Bacillus amyloliquefaciens FZB42 RBAM_037630 -193 6 TAGTACCTTTTTTGATACTA
Bacillus subtilis subsp. subtilis str. 168 BSU40550 -190 6 TAGTACCTTTTTTGATACTA
© 2009-2020 RegPrecise