Propagation of YdfL regulog to Bacillus subtilis subsp. subtilis str. SMY
| Source regulog: | YdfL - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus subtilis subsp. subtilis str. SMY |
| Orthologous TF(s) | BsubsS_010100003079 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -62
Score: 5.8 Sequence: GACTCTCTACTAACTAGAGGGTT
Locus tag: BsubsS_010100003074
|
||||
| BsubsS_010100003074 | -62 | 5.8 | GACTCTCTACTAACTAGAGGGTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ydfK | ||||
| Ortholog function: Putative integral inner membrane protein | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU05450 | -62 | 5.8 | GACTCTCTACTAACTAGAGGGTT |