Propagation of YdfL regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog:	YdfL - Bacillales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s)	BsubsS_010100003079
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. SMY*
	Locus tag	Position	Score	Sequence
Position: -62 Score: 5.8 Sequence: GACTCTCTACTAACTAGAGGGTT Locus tag: BsubsS_010100003074
	BsubsS_010100003074	-62	5.8	GACTCTCTACTAACTAGAGGGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ydfK
Ortholog function: Putative integral inner membrane protein
Bacillus subtilis subsp. subtilis str. 168	BSU05450	-62	5.8	GACTCTCTACTAACTAGAGGGTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --