Propagation of GltR regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog:	GltR - Bacillales
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	unknown
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s)	BsubsS_010100014557
Regulated genes	2

Built upon 5 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. SMY*
	Locus tag	Position	Score	Sequence
Position: -280 Score: 5.8 Sequence: GACATCTCAAAATCAGATATC Locus tag: BsubsS_010100014557
	BsubsS_010100014557	-280	5.8	GACATCTCAAAATCAGATATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: gltR
Ortholog function: Transcriptional regulator, LysR family
Bacillus subtilis subsp. subtilis str. 168	BSU26670	-37	5.8	GACATCTCAAAATCAGATATC
Paenibacillus sp. JDR-2	Pjdr2_3123	-50	5.4	GATATCATTTTTTCAGATATT

Position: -241 Score: 5.8 Sequence: GACATCTCAAAATCAGATATC Locus tag: BsubsS_010100014622
	BsubsS_010100014622	-241	5.8	GACATCTCAAAATCAGATATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yrpB
Ortholog function: Probable nitronate monooxygenase (EC 1.13.12.16)
Bacillus subtilis subsp. subtilis str. 168	BSU26800	-241	5.8	GACATCTCAAAATCAGATATC
Paenibacillus sp. JDR-2	Pjdr2_3122	-111	5.3	GCTATCTCTTTTCGGGATAGC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --