Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CzrA regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog: CzrA - Bacillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s) BsubsS_010100010522
Regulated genes 2
Built upon 16 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. SMY
Locus tag Position Score Sequence
Position: -116
Score: 7.1
Sequence: TATATGAACACATGCTCATATA
Locus tag: BsubsS_010100014547
BsubsS_010100014547 -116 7.1 TATATGAACACATGCTCATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: czcD
Ortholog function: Cation diffusion facilitator family transporter
Bacillus subtilis subsp. subtilis str. 168 BSU26650 -116 7.1 TATATGAACACATGCTCATATA
Bacillus amyloliquefaciens FZB42 RBAM_005600 -106 6.9 TATATGAGCACATAATCATATA
Bacillus licheniformis DSM 13 BLi03452 -45 6.6 AATATGAATACATGATCATATA
Geobacillus kaustophilus HTA426 GK1407 -43 7.1 TATATGAACAAATGCTCATATA
Geobacillus kaustophilus HTA426 GK0581 -48 7 CATATGAACATATGCTCATATA
Bacillus clausii KSM-K16 ABC3389 -36 6.8 AATATGAACATATAATCATATA
Oceanobacillus iheyensis HTE831 OB1399 -39 6.7 AATATGAGCATATGATCATATT
Paenibacillus sp. JDR-2 Pjdr2_0376 -44 6.1 CATATGAATAGTTGTTCATATA
Position: -94
Score: 7.3
Sequence: TATATGAGTATATGCTCATATA
Locus tag: BsubsS_010100018216
BsubsS_010100018216 -94 7.3 TATATGAGTATATGCTCATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cadA
Ortholog function: Cadmium-transporting ATPase (EC 3.6.3.3)
Bacillus subtilis subsp. subtilis str. 168 BSU33490 -94 7.3 TATATGAGTATATGCTCATATA
Bacillus amyloliquefaciens FZB42 RBAM_030670 -87 7.3 TATATGAGTATATGTTCATATA
Bacillus pumilus SAFR-032 BPUM_3010 -87 7.3 TATATGAATATATGCTCATATA
Bacillus licheniformis DSM 13 BLi03539 -61 6.9 TATATGCGTATATGCTCATATA
Bacillus cereus ATCC 14579 BC0596 -46 5.7 TATATGAatgatTGtTCATATg