Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of FadR regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog: FadR - Bacillales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Palmitoyl-CoA; Oleoyl-CoA
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s) BsubsS_010100015557
Regulated genes 5
Built upon 48 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. SMY
Locus tag Position Score Sequence
Position: -35
Score: 6.5
Sequence: ATGAATGACTATTCATTCAC
Locus tag: BsubsS_010100005687
BsubsS_010100005687 -35 6.5 ATGAATGACTATTCATTCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: lcfB
Ortholog function: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Bacillus subtilis subsp. subtilis str. 168 BSU10270 -35 6.5 ATGAATGACTATTCATTCAC
Bacillus amyloliquefaciens FZB42 RBAM_010470 -44 6.9 ATGAATGACTATTCATTCAT
Bacillus pumilus SAFR-032 BPUM_0969 -44 6.5 ATGAATGGTTATTCATTCAT
Bacillus licheniformis DSM 13 BLi01103 -39 6.3 ATGAATGGTCATTCATTCAT
Position: -36
Score: 6.4
Sequence: TTGAATGAATAATCATTCAC
Locus tag: BsubsS_010100007792
BsubsS_010100007792 -36 6.4 TTGAATGAATAATCATTCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: ykuF
Ortholog function: 2,4-dienoyl-CoA reductase, mitochondrial precursor (EC 1.3.1.34)
Bacillus subtilis subsp. subtilis str. 168 BSU14060 -36 6.4 TTGAATGAATAATCATTCAC
Bacillus amyloliquefaciens FZB42 RBAM_013850 -40 6.8 ATGAATGATTATTCATTCAA
Bacillus pumilus SAFR-032 BPUM_1303 -40 6.7 ATGAATGAATAGTCATTCAA
Bacillus licheniformis DSM 13 BLi01620 -36 6.8 TTGAATGAATACTCATTCAT
Anoxybacillus flavithermus WK1 Aflv_1909 -37 6.5 ATGAATGAATAACCATTCAT
Geobacillus kaustophilus HTA426 GK1044 -34 6.5 ATGAATGAGTAATCAGTCAT
Bacillus cereus ATCC 14579 BC3990 -29 5.2 ATGAATGTGTATTCATTTTT
Bacillus halodurans C-125 BH2144 -38 6.8 TTGAATGAATATTCATTCAA
Position: -44
Score: 6.9
Sequence: ATGAATGAATAGTCATTCAT
Locus tag: BsubsS_010100015557
BsubsS_010100015557 -44 6.9 ATGAATGAATAGTCATTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadR
Ortholog function: Transcriptional regulator of fatty acids degradation, TetR family
Bacillus subtilis subsp. subtilis str. 168 BSU28550 -44 6.9 ATGAATGAATAGTCATTCAT
Bacillus amyloliquefaciens FZB42 RBAM_025610 -38 6.9 ATGAATGAATAGTCATTCAT
Bacillus pumilus SAFR-032 BPUM_2512 -41 6.8 ATGAATGAATACTCATTCAA
Bacillus licheniformis DSM 13 BLi03002 -43 6.9 ATGAATGAGTATTCATTCAT
Anoxybacillus flavithermus WK1 Aflv_0565 -44 6.9 ATGAATGATTATTCATTCAT
Geobacillus kaustophilus HTA426 GK2689 -60 6.1 ATGAATGATGGTTCATTCAT
Bacillus cereus ATCC 14579 BC4525 -45 6.6 ATGAATGACTATTCATTCAG
Bacillus halodurans C-125 BH3102 -38 6.9 ATGAATGAATACTCATTCAT
Bacillus clausii KSM-K16 ABC2672 -45 6.8 ATGAATGAACATTCATTCAT
Oceanobacillus iheyensis HTE831 OB2121 -50 5.9 ATGAATGATCATTCACTCAG
Position: -39
Score: 6.7
Sequence: ATGAATGACTATTCATTCAA
Locus tag: BsubsS_010100017846
BsubsS_010100017846 -39 6.7 ATGAATGACTATTCATTCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadN
Ortholog function: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
Bacillus subtilis subsp. subtilis str. 168 BSU32840 39 6.7 ATGAATGACTATTCATTCAA
Bacillus amyloliquefaciens FZB42 RBAM_029920 -39 6.7 ATGAATGACTATTCATTCAA
Bacillus pumilus SAFR-032 BPUM_2942 -39 6.5 ATGAATGACTGTTCATTCAA
Bacillus licheniformis DSM 13 BLi03466 -39 6.8 ATGAATGAGTATTCATTCAA
Geobacillus kaustophilus HTA426 GK3008 -40 6.5 ATGAATGACCATTCATTCAA
Bacillus cereus ATCC 14579 BC5004 -38 6.5 TTGAATGAGCATTCATTCAA
Bacillus halodurans C-125 BH3488 -36 6.5 ATGAATGAGTATTCATTCGT
Bacillus clausii KSM-K16 ABC2990 -46 5.9 ATGAATGAGTGTTCATTCGG
Oceanobacillus iheyensis HTE831 OB2395 -41 6.6 ATGAATGAGCATTCATTCAA
Position: -98
Score: 6.3
Sequence: TTGACTGAACACTCATTCAT
Locus tag: BsubsS_010100020116
BsubsS_010100020116 -98 6.3 TTGACTGAACACTCATTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadF
Ortholog function: Fe-S oxidoreductase
Bacillus subtilis subsp. subtilis str. 168 BSU37180 -98 6.3 TTGACTGAACACTCATTCAT
Bacillus amyloliquefaciens FZB42 RBAM_034330 -82 6.3 TTGACTGAACACTCATTCAT
Bacillus pumilus SAFR-032 BPUM_3374 -88 6.6 TTGACTGAATACTCATTCAT
Bacillus licheniformis DSM 13 BLi03969 -82 6.3 TTGACTGAACACTCATTCAT
Anoxybacillus flavithermus WK1 Aflv_2740 -85 6.3 TTGACTGAATGCTCATTCAT
Geobacillus kaustophilus HTA426 GK3398 -106 6.3 TTGACTGAATGCTCATTCAT
Bacillus cereus ATCC 14579 BC5345 -115 5.9 TTGACTGAATGCTCACTCAT
Bacillus halodurans C-125 BH3802 -123 6.5 ATGAGTGAATACTCATTCAT
Bacillus clausii KSM-K16 ABC3892 -109 6.2 CTGACTGAATGCTCATTCAT
Oceanobacillus iheyensis HTE831 OB3014 -106 6.3 TTGACTGAATGATCATTCAT