Propagation of PadR regulog to Bacillus subtilis subsp. subtilis str. SMY
| Source regulog: | PadR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Phenolic acid stress response |
| Effector: | p-Coumaric acid; Ferulic acid |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus subtilis subsp. subtilis str. SMY |
| Orthologous TF(s) | BsubsS_010100004619 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -192
Score: 6.8 Sequence: GAACATGTAAATAGTTACATGATT
Locus tag: BsubsS_010100018686
|
||||
| BsubsS_010100018686 | -192 | 6.8 | GAACATGTAAATAGTTACATGATT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yveG | ||||
| Ortholog function: Hypothetical protein | ||||
| Bacillus amyloliquefaciens FZB42 | RBAM_031740 | -95 | 7.1 | AAACGTGTAAATAGTTACATGTTT |
| Bacillus subtilis subsp. subtilis str. 168 | BSU34410 | -48 | 6.8 | GAACATGTAAATAGTTACATGATT |