Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of FadR regulog to Alicyclobacillus acidocaldarius LAA1

Reference regulog properties
Source regulog: FadR - Bacillales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Palmitoyl-CoA; Oleoyl-CoA
Phylum: Firmicutes
Propagated regulon:
Target genome Alicyclobacillus acidocaldarius LAA1
Orthologous TF(s) AaLAA1DRAFT_0957
Regulated genes 2
Built upon 48 sites [see more]
Predicted regulatory interactions in Alicyclobacillus acidocaldarius LAA1
Locus tag Position Score Sequence
Position: -53
Score: 6.5
Sequence: ATGAATGAGCGTTCATTCAT
Locus tag: AaLAA1DRAFT_0957
AaLAA1DRAFT_0957 -53 6.5 ATGAATGAGCGTTCATTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadR
Ortholog function: Transcriptional regulator of fatty acids degradation, TetR family
Bacillus subtilis subsp. subtilis str. 168 BSU28550 -44 6.9 ATGAATGAATAGTCATTCAT
Bacillus amyloliquefaciens FZB42 RBAM_025610 -38 6.9 ATGAATGAATAGTCATTCAT
Bacillus pumilus SAFR-032 BPUM_2512 -41 6.8 ATGAATGAATACTCATTCAA
Bacillus licheniformis DSM 13 BLi03002 -43 6.9 ATGAATGAGTATTCATTCAT
Anoxybacillus flavithermus WK1 Aflv_0565 -44 6.9 ATGAATGATTATTCATTCAT
Geobacillus kaustophilus HTA426 GK2689 -60 6.1 ATGAATGATGGTTCATTCAT
Bacillus cereus ATCC 14579 BC4525 -45 6.6 ATGAATGACTATTCATTCAG
Bacillus halodurans C-125 BH3102 -38 6.9 ATGAATGAATACTCATTCAT
Bacillus clausii KSM-K16 ABC2672 -45 6.8 ATGAATGAACATTCATTCAT
Oceanobacillus iheyensis HTE831 OB2121 -50 5.9 ATGAATGATCATTCACTCAG
Position: -190
Score: 6.5
Sequence: ATGAATGAACGCTCATTCAT
Locus tag: AaLAA1DRAFT_0958
AaLAA1DRAFT_0958 -190 6.5 ATGAATGAACGCTCATTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadF
Ortholog function: Fe-S oxidoreductase
Bacillus subtilis subsp. subtilis str. 168 BSU37180 -98 6.3 TTGACTGAACACTCATTCAT
Bacillus amyloliquefaciens FZB42 RBAM_034330 -82 6.3 TTGACTGAACACTCATTCAT
Bacillus pumilus SAFR-032 BPUM_3374 -88 6.6 TTGACTGAATACTCATTCAT
Bacillus licheniformis DSM 13 BLi03969 -82 6.3 TTGACTGAACACTCATTCAT
Anoxybacillus flavithermus WK1 Aflv_2740 -85 6.3 TTGACTGAATGCTCATTCAT
Geobacillus kaustophilus HTA426 GK3398 -106 6.3 TTGACTGAATGCTCATTCAT
Bacillus cereus ATCC 14579 BC5345 -115 5.9 TTGACTGAATGCTCACTCAT
Bacillus halodurans C-125 BH3802 -123 6.5 ATGAGTGAATACTCATTCAT
Bacillus clausii KSM-K16 ABC3892 -109 6.2 CTGACTGAATGCTCATTCAT
Oceanobacillus iheyensis HTE831 OB3014 -106 6.3 TTGACTGAATGATCATTCAT
© 2009-2020 RegPrecise