Propagation of YtrA regulog to Alicyclobacillus acidocaldarius LAA1

Reference regulog properties
Source regulog:	YtrA - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Ramoplanin resistance
Effector:	Ramoplanin
Phylum:	Firmicutes
Propagated regulon:
Target genome	Alicyclobacillus acidocaldarius LAA1
Orthologous TF(s)	AaLAA1DRAFT_1223
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Alicyclobacillus acidocaldarius LAA1*
	Locus tag	Position	Score	Sequence
Position: -67 Score: 6 Sequence: TGTACTATACGAACTAGTACA Locus tag: AaLAA1DRAFT_1223
	AaLAA1DRAFT_1223	-67	6	TGTACTATACGAACTAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Transcriptional regulator, GntR family
Bacillus subtilis subsp. subtilis str. 168	BSU30460	-244	6.5	TGTACTAATTGAAGTAATACA
Bacillus amyloliquefaciens FZB42	RBAM_027400	-238	6.7	TGTACTACTTGATGTAATACA
Bacillus pumilus SAFR-032	BPUM_2677	-234	6.4	TGTACTACATCAACTAATACA
Bacillus licheniformis DSM 13	BLi03185	-223	6.4	TGTACTACATCGAGTAATACA
Geobacillus kaustophilus HTA426	GK1620	-49	5.9	TGTACTATTAGTTATAGTACG
Bacillus cereus ATCC 14579	BC4076	-46	6.4	TGTATTACATATAGTAGTACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --