Propagation of YbzH regulog to Bacillus subtilis subsp. subtilis str. JH642

Reference regulog properties
Source regulog:	YbzH - Bacillales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Metabolite transport
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. JH642
Orthologous TF(s)	BsubsJ_010100001068
Regulated genes	2

Built upon 8 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. JH642*
	Locus tag	Position	Score	Sequence
Position: -30 Score: 6.6 Sequence: ATATCGAAATATAACGATAT Locus tag: BsubsJ_010100001068
	BsubsJ_010100001068	-30	6.6	ATATCGAAATATAACGATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybzH
Ortholog function: Transcriptional regulator, ArsR family
Bacillus amyloliquefaciens FZB42	RBAM_018560	-30	6.4	ATATCGTAAAATCACGATAT
Bacillus clausii KSM-K16	ABC1381	-30	5.5	ATATCGCAAAATGTAGATAT
Bacillus licheniformis DSM 13	BLi00209	-29	6.1	ATATTGACAATTTTCGATAT
Bacillus subtilis subsp. subtilis str. 168	BSU01889	-30	6.6	ATATCGAAATATAACGATAT

Position: -90 Score: 6.4 Sequence: ATATCGACATATTACGATGT Locus tag: BsubsJ_010100001073
	BsubsJ_010100001073	-90	6.4	ATATCGACATATTACGATGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybcL
Ortholog function: Putative efflux transporter
Bacillus amyloliquefaciens FZB42	RBAM_018550	-56	6.2	ATATCGATATATCACAATAT
Bacillus clausii KSM-K16	ABC1382	-75	5.9	ACATCGACATATCGCGATAT
Bacillus licheniformis DSM 13	BLi00210	-93	6.5	ATATCGACATATTTCGATGT
Bacillus subtilis subsp. subtilis str. 168	BSU01890	-90	6.4	ATATCGACATATTACGATGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --