Propagation of YbzH regulog to Bacillus subtilis subsp. subtilis str. JH642
| Source regulog: | YbzH - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus subtilis subsp. subtilis str. JH642 |
| Orthologous TF(s) | BsubsJ_010100001068 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -30
Score: 6.6 Sequence: ATATCGAAATATAACGATAT
Locus tag: BsubsJ_010100001068
|
||||
| BsubsJ_010100001068 | -30 | 6.6 | ATATCGAAATATAACGATAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ybzH | ||||
| Ortholog function: Transcriptional regulator, ArsR family | ||||
| Bacillus amyloliquefaciens FZB42 | RBAM_018560 | -30 | 6.4 | ATATCGTAAAATCACGATAT |
| Bacillus clausii KSM-K16 | ABC1381 | -30 | 5.5 | ATATCGCAAAATGTAGATAT |
| Bacillus licheniformis DSM 13 | BLi00209 | -29 | 6.1 | ATATTGACAATTTTCGATAT |
| Bacillus subtilis subsp. subtilis str. 168 | BSU01889 | -30 | 6.6 | ATATCGAAATATAACGATAT |
|
Position: -90
Score: 6.4 Sequence: ATATCGACATATTACGATGT
Locus tag: BsubsJ_010100001073
|
||||
| BsubsJ_010100001073 | -90 | 6.4 | ATATCGACATATTACGATGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ybcL | ||||
| Ortholog function: Putative efflux transporter | ||||
| Bacillus amyloliquefaciens FZB42 | RBAM_018550 | -56 | 6.2 | ATATCGATATATCACAATAT |
| Bacillus clausii KSM-K16 | ABC1382 | -75 | 5.9 | ACATCGACATATCGCGATAT |
| Bacillus licheniformis DSM 13 | BLi00210 | -93 | 6.5 | ATATCGACATATTTCGATGT |
| Bacillus subtilis subsp. subtilis str. 168 | BSU01890 | -90 | 6.4 | ATATCGACATATTACGATGT |