Propagation of YhcF regulog to Bacillus subtilis subsp. subtilis str. JH642

Reference regulog properties
Source regulog:	YhcF - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. JH642
Orthologous TF(s)	BsubsJ_010100004898
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. JH642*
	Locus tag	Position	Score	Sequence
Position: -49 Score: 6.4 Sequence: GTGTACTATGTTACTCATACAC Locus tag: BsubsJ_010100004893
	BsubsJ_010100004893	-49	6.4	GTGTACTATGTTACTCATACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcE
Ortholog function: Putative integral inner membrane protein
Bacillus subtilis subsp. subtilis str. 168	BSU09050	-49	6.4	GTGTACTATGTTACTCATACAC
Bacillus amyloliquefaciens FZB42	RBAM_009320	-46	6.4	GTGTACTATGTTACTCATACAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --