Propagation of BltR regulog to Bacillus subtilis subsp. subtilis str. JH642
| Source regulog: | BltR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus subtilis subsp. subtilis str. JH642 |
| Orthologous TF(s) | BsubsJ_010100014368 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -104
Score: 6.6 Sequence: GACTATACGGTAACCATATACCT
Locus tag: BsubsJ_010100014373
|
||||
| BsubsJ_010100014373 | -104 | 6.6 | GACTATACGGTAACCATATACCT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: blt | ||||
| Ortholog function: Multidrug resistance protein, major facilitator (MFS) superfamily | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU26590 | -104 | 6.6 | GACTATACGGTAACCATATACCT |