Propagation of YdfD/YisV regulog to Bacillus subtilis subsp. subtilis str. JH642

Reference regulog properties
Source regulog:	YdfD/YisV - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/MocR
Regulation mode:	repressor (activator)
Biological process:	Metabolite transport
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. JH642
Orthologous TF(s)	BsubsJ_010100002958, BsubsJ_010100005891
Regulated genes	2

Built upon 14 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. JH642*
	Locus tag	Position	Score	Sequence
Position: -108 Score: 7 Sequence: TGGTTGGGTCAAAATCTATTGAACTGGTTGA Locus tag: BsubsJ_010100002953
	BsubsJ_010100002953	-108	7	TGGTTGGGTCAAAATCTATTGAACTGGTTGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ydfC
Ortholog function: Permease of the drug/metabolite transporter (DMT) superfamily
Bacillus subtilis subsp. subtilis str. 168	BSU05360	-108	7	TGGTTGGGTCAAAATCTATTGAACTGGTTGA

Position: -39 Score: 6 Sequence: TGGCTGGTTCCTAACCCAACCAAATGGCTGG Locus tag: BsubsJ_010100005886
	BsubsJ_010100005886	-39	6	TGGCTGGTTCCTAACCCAACCAAATGGCTGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yisU
Ortholog function: Hypothetical efflux transporter, LysE family
Bacillus subtilis subsp. subtilis str. 168	BSU10870	-39	6	TGGCTGGTTCCTAACCCAACCAAATGGCTGG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --