Propagation of GanR regulog to Bacillus subtilis subsp. subtilis str. JH642
| Source regulog: | GanR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactan utilization |
| Effector: | Beta-galactosides |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus subtilis subsp. subtilis str. JH642 |
| Orthologous TF(s) | BsubsJ_010100018405 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -109
Score: 5.9 Sequence: TTAGGTAAAAAAATTTACTCTA
Locus tag: BsubsJ_010100018400
|
||||
| BsubsJ_010100018400 | -109 | 5.9 | TTAGGTAAAAAAATTTACTCTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ganO | ||||
| Ortholog function: Arabinogalactan oligomer ABC transporter, binding protein | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU34160 | -109 | 5.9 | TTAGGTAAAAAAATTTACTCTA |
| Bacillus pumilus SAFR-032 | BPUM_3613 | -126 | 6.8 | TTGAGTAAAAAATTTTACTTAA |
| Bacillus licheniformis DSM 13 | BLi04280 | -110 | 5.8 | TTTCGTAAAACATTTTACCTGT |
| Bacillus halodurans C-125 | BH2019 | -127 | 5.9 | TTTCCGAAAATATTTTACTCAT |
| Bacillus clausii KSM-K16 | ABC3520 | -108 | 7.2 | TTAAGTAAAATATTTTACTAAA |
|
Position: -54
Score: 6.6 Sequence: GAAAGTAAAATATTTTACTAAA
Locus tag: BsubsJ_010100018405
|
||||
| BsubsJ_010100018405 | -54 | 6.6 | GAAAGTAAAATATTTTACTAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ganR | ||||
| Ortholog function: Transcriptional regulator of galactan utilization operon, LacI family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU34170 | -54 | 6.6 | GAAAGTAAAATATTTTACTAAA |
| Bacillus pumilus SAFR-032 | BPUM_3612 | -74 | 5.6 | TTTAATAAAAATATTTACTAAT |
| Bacillus licheniformis DSM 13 | BLi04281 | -69 | 7 | ATTAGTAAAATATTTTACTAAA |