Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PadR regulog to Bacillus subtilis subsp. subtilis str. JH642

Reference regulog properties
Source regulog: PadR - Bacillales
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Phenolic acid stress response
Effector: p-Coumaric acid; Ferulic acid
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. JH642
Orthologous TF(s) BsubsJ_010100004523
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. JH642
Locus tag Position Score Sequence
Position: -192
Score: 6.8
Sequence: GAACATGTAAATAGTTACATGATT
Locus tag: BsubsJ_010100018530
BsubsJ_010100018530 -192 6.8 GAACATGTAAATAGTTACATGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yveG
Ortholog function: Hypothetical protein
Bacillus amyloliquefaciens FZB42 RBAM_031740 -95 7.1 AAACGTGTAAATAGTTACATGTTT
Bacillus subtilis subsp. subtilis str. 168 BSU34410 -48 6.8 GAACATGTAAATAGTTACATGATT