Propagation of PadR regulog to Bacillus subtilis subsp. subtilis str. JH642
Source regulog: | PadR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | PadR |
Regulation mode: | repressor |
Biological process: | Phenolic acid stress response |
Effector: | p-Coumaric acid; Ferulic acid |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus subtilis subsp. subtilis str. JH642 |
Orthologous TF(s) | BsubsJ_010100004523 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -192
Score: 6.8 Sequence: GAACATGTAAATAGTTACATGATT
Locus tag: BsubsJ_010100018530
|
||||
BsubsJ_010100018530 | -192 | 6.8 | GAACATGTAAATAGTTACATGATT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yveG | ||||
Ortholog function: Hypothetical protein | ||||
Bacillus amyloliquefaciens FZB42 | RBAM_031740 | -95 | 7.1 | AAACGTGTAAATAGTTACATGTTT |
Bacillus subtilis subsp. subtilis str. 168 | BSU34410 | -48 | 6.8 | GAACATGTAAATAGTTACATGATT |