Propagation of YbzH regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610
Source regulog: | YbzH - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Metabolite transport |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus subtilis subsp. subtilis str. NCIB 3610 |
Orthologous TF(s) | BsubsN3_010100001066 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -30
Score: 6.6 Sequence: ATATCGAAATATAACGATAT
Locus tag: BsubsN3_010100001066
|
||||
BsubsN3_010100001066 | -30 | 6.6 | ATATCGAAATATAACGATAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ybzH | ||||
Ortholog function: Transcriptional regulator, ArsR family | ||||
Bacillus amyloliquefaciens FZB42 | RBAM_018560 | -30 | 6.4 | ATATCGTAAAATCACGATAT |
Bacillus clausii KSM-K16 | ABC1381 | -30 | 5.5 | ATATCGCAAAATGTAGATAT |
Bacillus licheniformis DSM 13 | BLi00209 | -29 | 6.1 | ATATTGACAATTTTCGATAT |
Bacillus subtilis subsp. subtilis str. 168 | BSU01889 | -30 | 6.6 | ATATCGAAATATAACGATAT |
Position: -90
Score: 6.4 Sequence: ATATCGACATATTACGATGT
Locus tag: BsubsN3_010100001071
|
||||
BsubsN3_010100001071 | -90 | 6.4 | ATATCGACATATTACGATGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ybcL | ||||
Ortholog function: Putative efflux transporter | ||||
Bacillus amyloliquefaciens FZB42 | RBAM_018550 | -56 | 6.2 | ATATCGATATATCACAATAT |
Bacillus clausii KSM-K16 | ABC1382 | -75 | 5.9 | ACATCGACATATCGCGATAT |
Bacillus licheniformis DSM 13 | BLi00210 | -93 | 6.5 | ATATCGACATATTTCGATGT |
Bacillus subtilis subsp. subtilis str. 168 | BSU01890 | -90 | 6.4 | ATATCGACATATTACGATGT |