Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CcpB regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610

Reference regulog properties
Source regulog: CcpB - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Carbon catabolism
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. NCIB 3610
Orthologous TF(s) BsubsN3_010100021967
Regulated genes 2
Built upon 3 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. NCIB 3610
Locus tag Position Score Sequence
Position: -51
Score: 5.7
Sequence: AAATAAAATGCATCTGTATT
Locus tag: BsubsN3_010100009627
BsubsN3_010100009627 -51 5.7 AAATAAAATGCATCTGTATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylA
Ortholog function: Xylose isomerase (EC 5.3.1.5)
Bacillus subtilis subsp. subtilis str. 168 BSU17600 -51 5.7 AAATAAAATGCATCTGTATT
Bacillus amyloliquefaciens FZB42 RBAM_017350 -80 6 AACTAATGTGCAACATGACA
Position: -123
Score: 5.8
Sequence: ACATACCATGCAATATGGTA
Locus tag: BsubsN3_010100021507
BsubsN3_010100021507 -123 5.8 ACATACCATGCAATATGGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gntR
Ortholog function: Transcriptional repressor of gluconate operon, GntR family
Bacillus subtilis subsp. subtilis str. 168 BSU40050 -123 5.8 ACATACCATGCAATATGGTA