Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CzrA regulog to Geobacillus thermodenitrificans NG80-2

Reference regulog properties
Source regulog: CzrA - Bacillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Geobacillus thermodenitrificans NG80-2
Orthologous TF(s) GTNG_1266
Regulated genes 1
Built upon 16 sites [see more]
Predicted regulatory interactions in Geobacillus thermodenitrificans NG80-2
Locus tag Position Score Sequence
Position: -44
Score: 7.4
Sequence: TATATGAACATATGCTCATATA
Locus tag: GTNG_1266
GTNG_1266 -44 7.4 TATATGAACATATGCTCATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: czrA
Ortholog function: Transcriptional repressor of multiple metal-sensing, ArsR family
Anoxybacillus flavithermus WK1 Aflv_1335 -41 7.2 TATATGAACATATATTCATATA
Geobacillus kaustophilus HTA426 GK1406 -43 7.1 TATATGAACAAATGCTCATATA
Geobacillus kaustophilus HTA426 GK0580 -48 7 CATATGAACATATGCTCATATA
Bacillus clausii KSM-K16 ABC3390 -36 6.8 AATATGAACATATAATCATATA
Oceanobacillus iheyensis HTE831 OB1400 -39 6.7 AATATGAGCATATGATCATATT