Propagation of BltR regulog to Bacillus pumilus ATCC 7061
| Source regulog: | BltR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus pumilus ATCC 7061 |
| Orthologous TF(s) | BAT_2203 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -68
Score: 5.7 Sequence: GACTATGGAGTTACTCCACCCTT
Locus tag: BAT_2202
|
||||
| BAT_2202 | -68 | 5.7 | GACTATGGAGTTACTCCACCCTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yrkN | ||||
| Ortholog function: Possible acetyltransferase | ||||
| Bacillus pumilus SAFR-032 | BPUM_1819 | -32 | 5.7 | GACTATGGAGTTACTCCACCCTT |