Propagation of YvbF/YvaV regulog to Bacillus subtilis subsp. subtilis str. 168

Reference regulog properties
Source regulog:	YvbF/YvaV - Bacillales
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. 168
Orthologous TF(s)	BSU33840, BSU33740
Regulated genes	4

Built upon 12 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. 168*
	Locus tag	Position	Score	Sequence
Position: -110 Score: 7.1 Sequence: TAAACTTTTTATTTTATAAACTTTA Locus tag: BSU33730
	BSU33730	-110	7.1	TAAACTTTTTATTTTATAAACTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: opuCA
Ortholog function: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA
Bacillus amyloliquefaciens FZB42	RBAM_031050	-111	7.8	TAAACTTTTTAATTTACAAAGTTTA
Bacillus amyloliquefaciens FZB42	RBAM_031050	-111	7.8	TAAACTTTTTAATTTACAAAGTTTA
Bacillus subtilis subsp. subtilis str. 168	BSU33730	-110	7.1	TAAACTTTTTATTTTATAAACTTTA

Position: -198 Score: 7.1 Sequence: TAAAGTTTATAAAATAAAAAGTTTA Locus tag: BSU33740
	BSU33740	-198	7.1	TAAAGTTTATAAAATAAAAAGTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yvaV
Ortholog function: Transcriptional regulator of choline transport, MarR family
Bacillus amyloliquefaciens FZB42	RBAM_031060	-199	7.8	TAAACTTTGTAAATTAAAAAGTTTA
Bacillus subtilis subsp. subtilis str. 168	BSU33740	-198	7.1	TAAAGTTTATAAAATAAAAAGTTTA

Position: -85 Score: 7.5 Sequence: TAAACTTTTTATTTTACAAAGTTCA Locus tag: BSU33830
	BSU33830	-85	7.5	TAAACTTTTTATTTTACAAAGTTCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: opuCA
Ortholog function: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA
Bacillus pumilus SAFR-032	BPUM_3043	-89	7.4	TAAACTTTTTATTTTATAAAGTTTG
Bacillus subtilis subsp. subtilis str. 168	BSU33830	-85	7.5	TAAACTTTTTATTTTACAAAGTTCA

Position: -203 Score: 7.5 Sequence: TGAACTTTGTAAAATAAAAAGTTTA Locus tag: BSU33840
	BSU33840	-203	7.5	TGAACTTTGTAAAATAAAAAGTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yvbF
Ortholog function: Transcriptional regulator of choline transport, MarR family
Bacillus amyloliquefaciens FZB42	RBAM_031110	-201	7	TGAAATTTGTAAAATAAAAAGTTTA
Bacillus subtilis subsp. subtilis str. 168	BSU33840	-203	7.5	TGAACTTTGTAAAATAAAAAGTTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of YvbF/YvaV regulog to Bacillus subtilis subsp. subtilis str. 168

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --