Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LicR regulog to Bacillus subtilis subsp. subtilis str. 168

Reference regulog properties
Source regulog: LicR - Bacillales
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Beta-glucosides utilization
Effector: HPr, phosphocarrier protein; LicB, lichenan-specific enzyme IIB PTS component
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. 168
Orthologous TF(s) BSU38600
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. 168
Locus tag Position Score Sequence
Position: -111
Score: 5.5
Sequence: TTTTCCGTTGCCTGCGGAAAA
Locus tag: BSU38590
BSU38590 -111 5.5 TTTTCCGTTGCCTGCGGAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: licB
Ortholog function: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Bacillus subtilis subsp. subtilis str. 168 BSU38590 -111 5.5 TTTTCCGTTGCCTGCGGAAAA
Bacillus amyloliquefaciens FZB42 RBAM_035790 -109 6.2 TTTTCCGTTAACAGCGGAAAA
Bacillus pumilus SAFR-032 BPUM_3506 -105 5.7 TTTCCGCTTCCTAAAGGAAAA