Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NiaR regulog to Exiguobacterium sp. AT1b

Reference regulog properties
Source regulog: NiaR - Bacillales
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Propagated regulon:
Target genome Exiguobacterium sp. AT1b
Orthologous TF(s) EAT1b_2686
Regulated genes 2
Built upon 26 sites [see more]
Predicted regulatory interactions in Exiguobacterium sp. AT1b
Locus tag Position Score Sequence
Position: -43
Score: 5.6
Sequence: TACTCATGACAAGACACCTGTA
Locus tag: EAT1b_0711
EAT1b_0711 -43 5.6 TACTCATGACAAGACACCTGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaY
Ortholog function: Predicted nicotinate-regulated transporter NiaY
Bacillus halodurans C-125 BH3254 -85 5.3 GAAATGTGTCTTGTCATGTGTA
Bacillus clausii KSM-K16 ABC2773 -76 5 AAAAAGTGTCTTGTCACATGAA