Propagation of SdpR regulog to Geobacillus thermodenitrificans NG80-2

Reference regulog properties
Source regulog:	SdpR - Bacillales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Toxin-antitoxin system
Effector:	SdpI, signal transduction protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Geobacillus thermodenitrificans NG80-2
Orthologous TF(s)	GTNG_2030
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Geobacillus thermodenitrificans NG80-2*
	Locus tag	Position	Score	Sequence
Position: -135 Score: 6 Sequence: ATTTAGAAATGTATCTAAAT Locus tag: GTNG_2030
	GTNG_2030	-135	6	ATTTAGAAATGTATCTAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdpR
Ortholog function: Transcriptional regulator of SdpC resistance operon
Bacillus subtilis subsp. subtilis str. 168	BSU33790	-53	6.2	ATTTATACAAATATCTAAAT
Bacillus licheniformis DSM 13	BLi00787	-42	6.3	ATTTAGTTAAATAACTAAAT
Anoxybacillus flavithermus WK1	Aflv_1587	-71	6.1	AATTAGAAATTTGTCTAAAT
		-32	6.4	ATTTAGAAATTTGTCTAAAT
Geobacillus kaustophilus HTA426	GK2134	-148	5.4	ATTTAGATGTTTTTCTAAAC
Bacillus cereus ATCC 14579	BC4834	-47	6.1	GTTTAGATAAATATCTAAAT
Bacillus halodurans C-125	BH0945	-42	5.9	ATTTAAGTAATTGCTTAAAT
Paenibacillus sp. JDR-2	Pjdr2_5471	-54	6.4	ATTTAGAATATTATCTAAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --