Propagation of GudR regulog to Oceanobacillus iheyensis HTE831
| Source regulog: | GudR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Glucarate utilization; Galactarate utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Oceanobacillus iheyensis HTE831 |
| Orthologous TF(s) | OB2842 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -90
Score: 6.6 Sequence: TTTATTTGTCGGACAAATAAA
Locus tag: OB2842
|
||||
| OB2842 | -90 | 6.6 | TTTATTTGTCGGACAAATAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: gudR | ||||
| Ortholog function: Transcriptional regulator for glucarate/galactarate utilization, GntR family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU02500 | -42 | 5.5 | CTATTTTGTCTTACAATTGAA |
| Bacillus licheniformis DSM 13 | BLi00288 | -119 | 7 | TTTATTTGTCTTACAATTAAA |
| Bacillus clausii KSM-K16 | ABC0472 | -63 | 5.9 | CCTATTTGTATTACAATTAAA |
| Oceanobacillus iheyensis HTE831 | OB2842 | -90 | 6.6 | TTTATTTGTCGGACAAATAAA |