Propagation of YhcF regulog to Bacillus clausii KSM-K16
| Source regulog: | YhcF - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus clausii KSM-K16 |
| Orthologous TF(s) | ABC1460 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -49
Score: 6.5 Sequence: GTGTACTATTTAAATAGAACAC
Locus tag: ABC1458
|
||||
| ABC1458 | -49 | 6.5 | GTGTACTATTTAAATAGAACAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: bcrA | ||||
| Ortholog function: Bacitracin transport ATP-binding protein | ||||
| Bacillus clausii KSM-K16 | ABC1458 | -49 | 6.5 | GTGTACTATTTAAATAGAACAC |