Propagation of YybR/YdeP regulog to Bacillus thuringiensis str. Al Hakam

Reference regulog properties
Source regulog:	YybR/YdeP - Bacillales
Regulator type:	Transcription factor
Regulator family:	HxlR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus thuringiensis str. Al Hakam
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 21 sites [see more]

Predicted regulatory interactions in *Bacillus thuringiensis str. Al Hakam*
	Locus tag	Position	Score	Sequence
Position: -40 Score: 6.3 Sequence: TAGTATCTTTTTTGATACTA Locus tag: BALH_3003
	BALH_3003	-40	6.3	TAGTATCTTTTTTGATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfkO
Ortholog function: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34)
Bacillus cereus ATCC 14579	BC3321	-107	6.3	TAGTATCTTTTTTGATACTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --