Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YtrA regulog to Anoxybacillus flavithermus WK1

Reference regulog properties
Source regulog: YtrA - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Ramoplanin resistance
Effector: Ramoplanin
Phylum: Firmicutes
Propagated regulon:
Target genome Anoxybacillus flavithermus WK1
Orthologous TF(s) Aflv_1397
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Anoxybacillus flavithermus WK1
Locus tag Position Score Sequence
Position: -60
Score: 6.1
Sequence: CGTATTATTTAATATAATACA
Locus tag: Aflv_1397
Aflv_1397 -60 6.1 CGTATTATTTAATATAATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Transcriptional regulator, GntR family
Anoxybacillus flavithermus WK1 Aflv_1397 -60 6.1 CGTATTATTTAATATAATACA