Propagation of YtrA regulog to Anoxybacillus flavithermus WK1

Reference regulog properties
Source regulog:	YtrA - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Ramoplanin resistance
Effector:	Ramoplanin
Phylum:	Firmicutes
Propagated regulon:
Target genome	Anoxybacillus flavithermus WK1
Orthologous TF(s)	Aflv_1397
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Anoxybacillus flavithermus WK1*
	Locus tag	Position	Score	Sequence
Position: -60 Score: 6.1 Sequence: CGTATTATTTAATATAATACA Locus tag: Aflv_1397
	Aflv_1397	-60	6.1	CGTATTATTTAATATAATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Transcriptional regulator, GntR family
Anoxybacillus flavithermus WK1	Aflv_1397	-60	6.1	CGTATTATTTAATATAATACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --