Propagation of YybR/YdeP regulog to Bacillus megaterium DSM319
| Source regulog: | YybR/YdeP - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus megaterium DSM319 |
| Orthologous TF(s) | BMD_3871 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -193
Score: 6 Sequence: TAGTATAAAAAAGTATACTA
Locus tag: BMD_2289
|
||||
| BMD_2289 | -193 | 6 | TAGTATAAAAAAGTATACTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yfkO | ||||
| Ortholog function: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) | ||||
| Bacillus amyloliquefaciens FZB42 | RBAM_008000 | -100 | 5.5 | CAGTATCAAAATGAATACTA |
| Bacillus licheniformis DSM 13 | BLi00813 | -117 | 6.3 | TAGTATAAAAAATGATACTA |
| Bacillus subtilis subsp. subtilis str. 168 | BSU07830 | -103 | 6 | TGGTATCAAAATTGATACTA |
| Paenibacillus sp. JDR-2 | Pjdr2_4453 | -145 | 6 | TAGTATCCTTTTTAATACTA |