Propagation of NagR regulog to Bacillus megaterium DSM319

Reference regulog properties
Source regulog:	NagR - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus megaterium DSM319
Orthologous TF(s)	BMD_1158
Regulated genes	2

Built upon 14 sites [see more]

Predicted regulatory interactions in *Bacillus megaterium DSM319*
	Locus tag	Position	Score	Sequence
Position: -70 Score: 5.7 Sequence: CAACTGGTCTAGACAACTAT Locus tag: BMD_1160
	BMD_1160	-70	5.7	CAACTGGTCTAGACAACTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagA
Ortholog function: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Bacillus subtilis subsp. subtilis str. 168	BSU35010	-72	5.6	CAGCTGGTCTAGATCACTAG
Bacillus amyloliquefaciens FZB42	RBAM_032200	-73	6.2	TAACTGGTCTAGATAACTAG
Bacillus pumilus SAFR-032	BPUM_3138	-71	5.8	TTACTGGTATAGACAACTAT
Bacillus licheniformis DSM 13	BLi04348	-72	6.1	TTATTGGTCTAGACAACTAG
Geobacillus kaustophilus HTA426	GK2277	-63	5.8	TTAGTGGTATAGACAACTAG
Bacillus cereus ATCC 14579	BC4055	-99	6.4	TAGAATGTATAGACAACTAC
Bacillus halodurans C-125	BH0421	-157	5.2	AAATTGGTATATACAAATTA
Bacillus clausii KSM-K16	ABC1489	-79	6.5	TAATTGGTATAGACAACTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --