Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PadR regulog to Bacillus megaterium DSM319

Reference regulog properties
Source regulog: PadR - Bacillales
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Phenolic acid stress response
Effector: p-Coumaric acid; Ferulic acid
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus megaterium DSM319
Orthologous TF(s) BMD_0589
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Bacillus megaterium DSM319
Locus tag Position Score Sequence
Position: -244
Score: 7.4
Sequence: AAACATGTAAATAGTTACATGTTT
Locus tag: BMD_0380
BMD_0380 -244 7.4 AAACATGTAAATAGTTACATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padC
Ortholog function: Phenolic acid decarboxylase (EC 4.1.1.-)
Bacillus amyloliquefaciens FZB42 RBAM_031730 -95 7.1 AAACGTGTAAATAGTTACATGTTT
Bacillus licheniformis DSM 13 BLi03407 -58 6.6 ATATATGTAAATATCAACATGTTT
Bacillus pumilus SAFR-032 BPUM_0712 -59 6.9 AAACATGTAAATCACGACATGTTT
Bacillus subtilis subsp. subtilis str. 168 BSU34400 -48 6.8 GAACATGTAAATAGTTACATGATT