Propagation of YfmP regulog to Bacillus amyloliquefaciens FZB42

Reference regulog properties
Source regulog:	YfmP - Bacillales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Metal efflux
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus amyloliquefaciens FZB42
Orthologous TF(s)	RBAM_007640
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Bacillus amyloliquefaciens FZB42*
	Locus tag	Position	Score	Sequence
Position: -69 Score: 6.9 Sequence: AAGTTTACGTTTACGTTAAGGT Locus tag: RBAM_007640
	RBAM_007640	-69	6.9	AAGTTTACGTTTACGTTAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfmP
Ortholog function: Transcriptional regulator of metal efflux transporter expression, MerR family
Bacillus subtilis subsp. subtilis str. 168	BSU07390	-68	7	AACTTAACGTTTACGTTAAGGT
Bacillus amyloliquefaciens FZB42	RBAM_007640	-69	6.9	AAGTTTACGTTTACGTTAAGGT
Bacillus pumilus SAFR-032	BPUM_0692	-71	6.6	ACATTTACGTTTACGTTAAGGT
Bacillus licheniformis DSM 13	BLi00773	-65	6.8	AACTTAACGTTTACGTAAAAGT
Bacillus cereus ATCC 14579	BC5373	-50	6.5	AAGTTAACGTTAACGTAAAATG
Paenibacillus sp. JDR-2	Pjdr2_6009	-69	6.5	AAGTTAACGTTGACGTTAACAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --