Propagation of BltR regulog to Bacillus amyloliquefaciens FZB42

Reference regulog properties
Source regulog:	BltR - Bacillales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus amyloliquefaciens FZB42
Orthologous TF(s)	RBAM_006050
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Bacillus amyloliquefaciens FZB42*
	Locus tag	Position	Score	Sequence
Position: -120 Score: 6.4 Sequence: GACTATACGGTAACCATATCCTT Locus tag: RBAM_006040
	RBAM_006040	-120	6.4	GACTATACGGTAACCATATCCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: bltD
Ortholog function: Spermine/spermidine acetyltransferase
Bacillus subtilis subsp. subtilis str. 168	BSU26600	-104	6.6	GACTATACGGTAACCATATACCT
Bacillus amyloliquefaciens FZB42	RBAM_006040	-120	6.4	GACTATACGGTAACCATATCCTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --