Propagation of IolR regulog to Bacillus amyloliquefaciens FZB42

Reference regulog properties
Source regulog:	IolR - Bacillales
Regulator type:	Transcription factor
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:	2-deoxy-5-keto-D-gluconate 6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus amyloliquefaciens FZB42
Orthologous TF(s)	RBAM_036790
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Bacillus amyloliquefaciens FZB42*
	Locus tag	Position	Score	Sequence
Position: -224 Score: 6.5 Sequence: TAACCAAGAAATGACCAAAACA Locus tag: RBAM_036780
	RBAM_036780	-224	6.5	TAACCAAGAAATGACCAAAACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: iolA
Ortholog function: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
Bacillus subtilis subsp. subtilis str. 168	BSU39760	-196	6.4	TAACCAAGAAATGACCAAAAAG
Bacillus amyloliquefaciens FZB42	RBAM_036780	-224	6.5	TAACCAAGAAATGACCAAAACA
		-213	4.6	TGACCAAAACATAACCTGTAAA
Bacillus licheniformis DSM 13	BLi04251	-242	6.4	TAACCAAGAAGTGACCAAAACA
Bacillus clausii KSM-K16	ABC0422	-66	5.9	TAACCAACAAATGATCAAAAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --