Propagation of AseR regulog to Bacillus amyloliquefaciens FZB42

Reference regulog properties
Source regulog:	AseR - Bacillales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenite
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus amyloliquefaciens FZB42
Orthologous TF(s)	RBAM_035850
Regulated genes	1

Built upon 13 sites [see more]

Predicted regulatory interactions in *Bacillus amyloliquefaciens FZB42*
	Locus tag	Position	Score	Sequence
Position: -46 Score: 6.9 Sequence: TATATAAACATCTGCTTATATA Locus tag: RBAM_035850
	RBAM_035850	-46	6.9	TATATAAACATCTGCTTATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: aseR
Ortholog function: Transcriptional regulator of arsenic resistance, ArsR family
Bacillus amyloliquefaciens FZB42	RBAM_035850	-46	6.9	TATATAAACATCTGCTTATATA
Bacillus clausii KSM-K16	ABC0835	-66	6.9	TATATTAGCATTTACTTATATA
Oceanobacillus iheyensis HTE831	OB2425	-60	6	AACATAAGCATTGACTTATATA
		-44	7.4	TATATAAGCAAATGCTTATATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --