Propagation of ManR regulog to Bacillus amyloliquefaciens FZB42

Reference regulog properties
Source regulog:	ManR - Bacillales
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Mannose utilization
Effector:	ManP, mannose-specific enzyme IIBCA PTS component; HPr, phosphocarrier protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus amyloliquefaciens FZB42
Orthologous TF(s)	RBAM_024210
Regulated genes	2

Built upon 5 sites [see more]

Predicted regulatory interactions in *Bacillus amyloliquefaciens FZB42*
	Locus tag	Position	Score	Sequence
Position: -101 Score: 7.7 Sequence: TATTTCCGGAACTTATGGTAAAA Locus tag: RBAM_024200
	RBAM_024200	-101	7.7	TATTTCCGGAACTTATGGTAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manP
Ortholog function: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
Bacillus subtilis subsp. subtilis str. 168	BSU12010	-100	7.7	TATTACCGGAACCTATGGTAAAA
Bacillus amyloliquefaciens FZB42	RBAM_024200	-101	7.7	TATTTCCGGAACTTATGGTAAAA
Bacillus licheniformis DSM 13	BLi02108	-105	7.3	TTTTTCCGGAGCCTGCGGTAAAA

Position: -139 Score: 7.4 Sequence: TTTTTCCGGAACCTGCGGTAAAA Locus tag: RBAM_024210
	RBAM_024210	-139	7.4	TTTTTCCGGAACCTGCGGTAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manR
Ortholog function: transcriptional antiterminator
Bacillus subtilis subsp. subtilis str. 168	BSU12000	-136	6.6	TTTTTCCGGAAGCTTCGGTAAAA
Bacillus amyloliquefaciens FZB42	RBAM_024210	-139	7.4	TTTTTCCGGAACCTGCGGTAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --