Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YdfL regulog to Bacillus anthracis str. A0442

Reference regulog properties
Source regulog: YdfL - Bacillales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Multidrug resistance
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus anthracis str. A0442
Orthologous TF(s) BAH_1677
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Bacillus anthracis str. A0442
Locus tag Position Score Sequence
Position: -63
Score: 6.3
Sequence: GACCTTCAAGTTACTTGAAGGTT
Locus tag: BAH_1678
BAH_1678 -63 6.3 GACCTTCAAGTTACTTGAAGGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: BC1615
Ortholog function: Na+ driven multidrug efflux pump
Bacillus licheniformis DSM 13 BLi02817 -58 6.2 GACCTTCAAGTAACTTGAAGGTT
Bacillus cereus ATCC 14579 BC1615 -66 6.3 GACCTTCAAGTTACTTGAAGGTT