Propagation of HrcA regulog to Bacillus anthracis str. A0389
| Source regulog: | HrcA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus anthracis str. A0389 |
| Orthologous TF(s) | BAK_4622 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -43
Score: 7.4 Sequence: TTAGCACTCGAAGACAAAGAGTGCTAA
Locus tag: BAK_4622
|
||||
| BAK_4622 | -43 | 7.4 | TTAGCACTCGAAGACAAAGAGTGCTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: hrcA | ||||
| Ortholog function: Heat-inducible transcription repressor HrcA | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU25490 | -41 | 7.5 | TTAGCACTCGCTTATTGAGAGTGCTAA |
| Bacillus amyloliquefaciens FZB42 | RBAM_023790 | -41 | 7.3 | TTAGCACTCGCTGACCTTGAGTGCTAA |
| Bacillus pumilus SAFR-032 | BPUM_2282 | -41 | 7.5 | TTAGCACTCGTTGAAAGAGAGTGCTAA |
| Bacillus licheniformis DSM 13 | BLi02741 | -41 | 7.3 | TTAGCACTCAGTTGTGCCGAGTGCTAA |
| Anoxybacillus flavithermus WK1 | Aflv_0833 | -42 | 7.4 | TTAGCACTCGCTTTGTTAGAGTGCTAA |
| Geobacillus kaustophilus HTA426 | GK2506 | -41 | 7.4 | TTAGCACTCGAATTGTTCGAGTGCTAA |
| Bacillus cereus ATCC 14579 | BC4314 | -43 | 7.4 | TTAGCACTCAAAGACAAAGAGTGCTAA |
| Bacillus halodurans C-125 | BH1344 | -114 | 7.3 | TTAGCACTCGAACTATGAGAGTGCTAA |
| Bacillus clausii KSM-K16 | ABC1657 | -41 | 7.5 | TTAGCACTCGTTGCATTTGAGTGCTAA |
| Oceanobacillus iheyensis HTE831 | OB1970 | -41 | 7.4 | TTAGCACTCAATAATCAAGAGTGCTAA |
| Paenibacillus sp. JDR-2 | Pjdr2_2205 | -62 | 7.2 | TTAGCACTCGGGCCTAATGAGTGCTAA |