Propagation of YdfL regulog to Bacillus weihenstephanensis KBAB4

Reference regulog properties
Source regulog:	YdfL - Bacillales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus weihenstephanensis KBAB4
Orthologous TF(s)	BcerKBAB4_1527
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Bacillus weihenstephanensis KBAB4*
	Locus tag	Position	Score	Sequence
Position: -60 Score: 6.2 Sequence: GACCTTCAAGTAACTTGAAGGTT Locus tag: BcerKBAB4_1528
	BcerKBAB4_1528	-60	6.2	GACCTTCAAGTAACTTGAAGGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: BC1615
Ortholog function: Na+ driven multidrug efflux pump
Bacillus licheniformis DSM 13	BLi02817	-58	6.2	GACCTTCAAGTAACTTGAAGGTT
Bacillus cereus ATCC 14579	BC1615	-66	6.3	GACCTTCAAGTTACTTGAAGGTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --