Propagation of YhcF regulog to Bacillus weihenstephanensis KBAB4

Reference regulog properties
Source regulog:	YhcF - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus weihenstephanensis KBAB4
Orthologous TF(s)	BcerKBAB4_1278
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Bacillus weihenstephanensis KBAB4*
	Locus tag	Position	Score	Sequence
Position: -40 Score: 6.6 Sequence: GTGTACTATTTAACTAACACAC Locus tag: BcerKBAB4_1278
	BcerKBAB4_1278	-40	6.6	GTGTACTATTTAACTAACACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579	BC1356	-43	6.9	GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2	Pjdr2_3930	-44	5.5	GTGTACTATTCAACTATAACAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --