Propagation of NiaR regulog to Bacillus weihenstephanensis KBAB4

Reference regulog properties
Source regulog:	NiaR - Bacillales
Regulator type:	Transcription factor
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus weihenstephanensis KBAB4
Orthologous TF(s)	BcerKBAB4_4278
Regulated genes	2

Built upon 26 sites [see more]

Predicted regulatory interactions in *Bacillus weihenstephanensis KBAB4*
	Locus tag	Position	Score	Sequence
Position: -17 Score: 6.2 Sequence: TATAGGTGTCAAGACAGTTGGA Locus tag: BcerKBAB4_4276
	BcerKBAB4_4276	-17	6.2	TATAGGTGTCAAGACAGTTGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nadB
Ortholog function: L-aspartate oxidase (EC 1.4.3.16)
Anoxybacillus flavithermus WK1	Aflv_0703	-49	4.4	AATATATGTCAATATAGGTGTC
		-37	5.5	TATAGGTGTCAAGACAGTATGA
Geobacillus kaustophilus HTA426	GK2601	-41	6.1	TATAGATGTCAAGACAGGTGAA
Bacillus cereus ATCC 14579	BC4423	-47	6.2	TATAGGTGTCAAGACAGTTGGA

Position: -37 Score: 4.7 Sequence: ATGATGTGTAAAGACAGCTGTG Locus tag: BcerKBAB4_5212
	BcerKBAB4_5212	-37	4.7	ATGATGTGTAAAGACAGCTGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaP
Ortholog function: Niacin transporter NiaP
Bacillus subtilis subsp. subtilis str. 168	BSU02950	-63	5	ACAATGTGTAAAGACAGGTGTA
Bacillus amyloliquefaciens FZB42	RBAM_003210	-61	5	ACAATGTGTAAAGACAGGTGTA
Bacillus licheniformis DSM 13	BLi00841	-71	5.4	CAAAAGTGTAAAGACAGGTGTA
Geobacillus kaustophilus HTA426	GK3433	-39	5.2	TAAATATGTCTTTACATTGATA
Bacillus cereus ATCC 14579	BC5418	-37	4.7	ATGATGTGTAAAGACACCTGTG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --