Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YfmP regulog to Bacillus thuringiensis serovar konkukian str. 97-27

Reference regulog properties
Source regulog: YfmP - Bacillales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Metal efflux
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus thuringiensis serovar konkukian str. 97-27
Orthologous TF(s) BT9727_5053
Regulated genes 1
Built upon 7 sites [see more]
Predicted regulatory interactions in Bacillus thuringiensis serovar konkukian str. 97-27
Locus tag Position Score Sequence
Position: -49
Score: 6.5
Sequence: AAGTTAACGTTAACGTAAAATG
Locus tag: BT9727_5053
BT9727_5053 -49 6.5 AAGTTAACGTTAACGTAAAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfmP
Ortholog function: Transcriptional regulator of metal efflux transporter expression, MerR family
Bacillus subtilis subsp. subtilis str. 168 BSU07390 -68 7 AACTTAACGTTTACGTTAAGGT
Bacillus amyloliquefaciens FZB42 RBAM_007640 -69 6.9 AAGTTTACGTTTACGTTAAGGT
Bacillus pumilus SAFR-032 BPUM_0692 -71 6.6 ACATTTACGTTTACGTTAAGGT
Bacillus licheniformis DSM 13 BLi00773 -65 6.8 AACTTAACGTTTACGTAAAAGT
Bacillus cereus ATCC 14579 BC5373 -50 6.5 AAGTTAACGTTAACGTAAAATG
Paenibacillus sp. JDR-2 Pjdr2_6009 -69 6.5 AAGTTAACGTTGACGTTAACAT