Propagation of RutR regulog to Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701

Reference regulog properties
Source regulog:	RutR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701
Orthologous TF(s)	Sententer_010100019767
Regulated genes	1

Built upon 13 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701*
	Locus tag	Position	Score	Sequence
Position: -294 Score: 6.5 Sequence: ATTTGACCATTTGGTCCACT Locus tag: SeI_A4388
	SeI_A4388	-294	6.5	ATTTGACCATTTGGTCCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: carA
Ortholog function: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
Escherichia coli str. K-12 substr. MG1655	b0032	-294	6.5	TTTTGACCATTTGGTCCACT
Salmonella typhimurium LT2	STM0066	-294	6.5	ATTTGACCATTTGGTCCACT
Citrobacter koseri ATCC BAA-895	CKO_03351	-268	6.4	TTTTGACCAAATGGTCCACT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00040	-267	6.4	TTTTGACCATCTGGTCCACT
Enterobacter sp. 638	Ent638_0591	-294	5.8	TTTTGACCATTTGGTCTGGT
Erwinia amylovora ATCC 49946	EAM_0660	-297	6.2	TTCTGACCATTTGGTCCACT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --